Issue
Copyright (c) 2023 Samir Jawdat Bilal
This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
The undersigned hereby assign all rights, included but not limited to copyright, for this manuscript to CMB Association upon its submission for consideration to publication on Cellular and Molecular Biology. The rights assigned include, but are not limited to, the sole and exclusive rights to license, sell, subsequently assign, derive, distribute, display and reproduce this manuscript, in whole or in part, in any format, electronic or otherwise, including those in existence at the time this agreement was signed. The authors hereby warrant that they have not granted or assigned, and shall not grant or assign, the aforementioned rights to any other person, firm, organization, or other entity. All rights are automatically restored to authors if this manuscript is not accepted for publication.18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond
Corresponding Author(s) : Samir Jawdat Bilal
Cellular and Molecular Biology,
Vol. 70 No. 1: Issue 1
Abstract
Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.
Keywords
Download Citation
Endnote/Zotero/Mendeley (RIS)BibTeX
